| mod ID | Nm_site_2501 | mod Site | chr17:48088730-48088731:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | Gm | Sequence |
GAACGATACAGAGAAGATTAGCATGGCCCCTATGCAAAGAC |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | noScore | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
...............((((((...)))))). |
MFE | -5.80 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 1 | Support sub-Dataset Num | 1 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | GSE104947 | |||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List | GSE104947 | |||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | na | |||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | RiboMeth-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000225603.9,rmsk_4708515,ENST00000384227.1,ENST00000581003.5,ENST00000393408.7,ENST00000444685.1,ENST00000495350.5,ENST00000402583.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 2 | Writer Name List | FBL,NOP58 | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID | 29048444 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1