RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

Nm_site_3546

mod Site

chr20:58909385-58909386:+

mod Type

Sequence

GTGTCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTG

Motif Score

noScore

RNA Structure Motif

..((((..(((..((...))..)))))))..

MFE

-3.30

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE90164

Support sub-Dataset List

GSE90164

Cell/Tissue List

HeLa

Seq Type List

Nm-seq

Transcript ID List

ENST00000265620.11,ENST00000371095.7,ENST00000482112.5,ENST00000496934.5,ENST00000487862.5,ENST00000467321.5,ENST00000464624.6,ENST00000464788.5,ENST00000493958.5,ENST00000371100.8,ENST00000371075.7,ENST00000470512.5,ENST00000487981.5,ENST00000494081.5,ENST00000480232.5,ENST00000479025.1,ENST00000371085.7,ENST00000472183.5,ENST00000604005.5,ENST00000480975.5,ENST00000313949.11,ENST00000354359.11,ENST00000476935.5,ENST00000477931.5,ENST00000481039.5,ENST00000488652.5,ENST00000488546.5,ENST00000476196.5,ENST00000468895.5,ENST00000492907.5,ENST00000371102.8,ENST00000306090.11

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000265620.11	ENSG00000087460.24	GNAS	protein_coding	cds-7
ENST00000371095.7	ENSG00000087460.24	GNAS	protein_coding	cds-7
ENST00000482112.5	ENSG00000087460.24	GNAS	processed_transcript	exon-7
ENST00000496934.5	ENSG00000087460.24	GNAS	retained_intron	exon-6
ENST00000487862.5	ENSG00000087460.24	GNAS	retained_intron	exon-6
ENST00000467321.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000464624.6	ENSG00000087460.24	GNAS	processed_transcript	exon-9
ENST00000464788.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000493958.5	ENSG00000087460.24	GNAS	processed_transcript	exon-4
ENST00000371100.8	ENSG00000087460.24	GNAS	protein_coding	cds-8
ENST00000371075.7	ENSG00000087460.24	GNAS	protein_coding	utr3-8
ENST00000470512.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000487981.5	ENSG00000087460.24	GNAS	retained_intron	exon-5
ENST00000494081.5	ENSG00000087460.24	GNAS	processed_transcript	intron-3
ENST00000480232.5	ENSG00000087460.24	GNAS	processed_transcript	exon-9
ENST00000479025.1	ENSG00000087460.24	GNAS	retained_intron	exon-2
ENST00000371085.7	ENSG00000087460.24	GNAS	protein_coding	cds-8
ENST00000472183.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000604005.5	ENSG00000087460.24	GNAS	protein_coding	cds-8
ENST00000480975.5	ENSG00000087460.24	GNAS	processed_transcript	exon-7
ENST00000313949.11	ENSG00000087460.24	GNAS	protein_coding	utr3-8
ENST00000354359.11	ENSG00000087460.24	GNAS	protein_coding	cds-8
ENST00000476935.5	ENSG00000087460.24	GNAS	processed_transcript	exon-7
ENST00000477931.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000481039.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000488652.5	ENSG00000087460.24	GNAS	processed_transcript	exon-8
ENST00000488546.5	ENSG00000087460.24	GNAS	processed_transcript	exon-7
ENST00000476196.5	ENSG00000087460.24	GNAS	retained_intron	exon-5
ENST00000468895.5	ENSG00000087460.24	GNAS	processed_transcript	exon-7
ENST00000492907.5	ENSG00000087460.24	GNAS	processed_transcript	exon-7
ENST00000371102.8	ENSG00000087460.24	GNAS	protein_coding	cds-7
ENST00000306090.11	ENSG00000087460.24	GNAS	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

FBL,NOP58

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
FBL	FBL:CH406068	chr20:58909345-58909408	SBDH121-230825
NOP58	NOP58:CH433813	chr20:58909356-58909393	SBDH123-181290

PubMed ID

28504680

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.