| mod ID | Nm_site_4890 | mod Site | chr3:15309351-15309352:- | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | Gm | Sequence |
CCATCGATTCTCGGCCTTTTGGCTAAGATCAAGTGAAAACA |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | noScore | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
(((.((.((((....)))).)))))...... |
MFE | -9.30 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 4 | Support sub-Dataset Num | 4 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSE104947, Modomics, snOPY, snoRNABase |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | NA | |||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | RiboMeth-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000408919.7,rmsk_896110,ENST00000459627.1,ENST00000412806.1,ENST00000450625.1,ENST00000426925.5,ENST00000465894.6,ENST00000383791.8 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 1 | snoRNA Guide Site | U2:19 | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 3 | Writer Name List | FBL,NOP56,NOP58 | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1