RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

Nm_site_978

mod Site

chr11:62853674-62853675:-

mod Type

Sequence

GACTTGCTGTTGAGACTCTGAAATCTGATTTTCTGAGAATG

Motif Score

noScore

RNA Structure Motif

......((((.((........)).))))...

MFE

-2.60

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE90164

Support sub-Dataset List

GSE90164

Cell/Tissue List

HeLa

Seq Type List

Nm-seq

Transcript ID List

ENST00000545688.5,ENST00000541578.5,ENST00000545440.5,ENST00000535076.5,ENST00000538654.5,ENST00000539975.5,ENST00000537068.5,ENST00000538266.5,ENST00000544550.5,ENST00000540865.5,ENST00000541615.5,ENST00000539303.5,ENST00000384693.1,ENST00000537925.5,ENST00000537024.5,ENST00000540725.5,ENST00000542112.5,ENST00000537869.5,ENST00000539921.5,ENST00000535689.5,ENST00000545920.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000545688.5	ENSG00000255717.6	SNHG1	retained_intron	intron-6
ENST00000541578.5	ENSG00000255717.6	SNHG1	lincRNA	intron-6
ENST00000545440.5	ENSG00000255717.6	SNHG1	lincRNA	intron-4
ENST00000535076.5	ENSG00000255717.6	SNHG1	retained_intron	exon-1
ENST00000538654.5	ENSG00000255717.6	SNHG1	retained_intron	intron-3
ENST00000539975.5	ENSG00000255717.6	SNHG1	lincRNA	intron-3
ENST00000537068.5	ENSG00000255717.6	SNHG1	lincRNA	intron-6
ENST00000538266.5	ENSG00000255717.6	SNHG1	lincRNA	intron-4
ENST00000544550.5	ENSG00000255717.6	SNHG1	retained_intron	intron-6
ENST00000540865.5	ENSG00000255717.6	SNHG1	retained_intron	intron-5
ENST00000541615.5	ENSG00000255717.6	SNHG1	lincRNA	intron-5
ENST00000539303.5	ENSG00000255717.6	SNHG1	lincRNA	intron-5
ENST00000384693.1	ENSG00000277846.1	SNORD30	snoRNA	exon-1
ENST00000537925.5	ENSG00000255717.6	SNHG1	lincRNA	intron-6
ENST00000537024.5	ENSG00000255717.6	SNHG1	retained_intron	intron-5
ENST00000540725.5	ENSG00000255717.6	SNHG1	lincRNA	intron-6
ENST00000542112.5	ENSG00000255717.6	SNHG1	lincRNA	intron-5
ENST00000537869.5	ENSG00000255717.6	SNHG1	lincRNA	intron-5
ENST00000539921.5	ENSG00000255717.6	SNHG1	lincRNA	intron-5
ENST00000535689.5	ENSG00000255717.6	SNHG1	retained_intron	intron-6
ENST00000545920.1	ENSG00000255717.6	SNHG1	retained_intron	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

FBL,NOP56,NOP58

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
FBL	FBL:CH108414	chr11:62853624-62853739	SBDH121-59454
NOP56	NOP56:CH90822	chr11:62853606-62853738	SBDH120-54577
NOP58	NOP58:CH122349	chr11:62853611-62853736	SBDH124-90880

PubMed ID

28504680

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.