RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

Pseudo_site_2204

mod Site

chr17:45952020-45952021:+

mod Type

Sequence

TTTCCTGTCTGTGTATCGCTTCTCGGCCTTTTGGCTAAGAT

Motif Score

noScore

RNA Structure Motif

...................((((....))))

MFE

-5.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

snoRNABase, snOPY

Support sub-Dataset List

snoRNABase, snOPY

Cell/Tissue List

Seq Type List

Transcript ID List

rmsk_4703630,ENST00000334239.12,ENST00000262410.9,ENST00000535772.5,ENST00000340799.9,ENST00000351559.9,ENST00000446361.7,ENST00000570299.5,ENST00000571311.5,ENST00000344290.9

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
rmsk_4703630	rmsk_4703630	U2	snRNA	exon
ENST00000334239.12	ENSG00000186868.15	MAPT	protein_coding	intron-1
ENST00000262410.9	ENSG00000186868.15	MAPT	protein_coding	intron-1
ENST00000535772.5	ENSG00000186868.15	MAPT	protein_coding	intron-1
ENST00000340799.9	ENSG00000186868.15	MAPT	protein_coding	intron-1
ENST00000351559.9	ENSG00000186868.15	MAPT	protein_coding	intron-1
ENST00000446361.7	ENSG00000186868.15	MAPT	protein_coding	intron-1
ENST00000570299.5	ENSG00000186868.15	MAPT	processed_transcript	intron-1
ENST00000571311.5	ENSG00000186868.15	MAPT	nonsense_mediated_decay	intron-1
ENST00000344290.9	ENSG00000186868.15	MAPT	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

U2:7

snoRNA Guide Detail

snoRNA Guide Site	snoRNA Guide Base	snoRNA Name	Box	Source Database
U2:7	U	SCARNA14	H/ACA	snOPY
U2:7	U	SCARNA14	cajalH/ACA	snoRNABase

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

16381836, 24148649

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.