Details of RNA Modification Site of hg38
mod ID Pseudo_site_4914 mod Site chrX:68102105-68102106:-
mod Type Y Sequence TGGCAGTACATATACTAAAATTGGAACGATACAGAGAAGAT
Motif Score noScore
RNA Structure Motif ...............................
 MFE 0.00
Support Dataset Num 2 Support sub-Dataset Num 2
Support Dataset List snOPY, snoRNABase
Support sub-Dataset List snOPY, snoRNABase
Cell/Tissue List na
Seq Type List na
Transcript ID List rmsk_3024864,ENST00000484842.1,ENST00000516336.1,ENST00000355520.6
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
rmsk_3024864rmsk_3024864U6snRNAexon
ENST00000484842.1ENSG00000079482.13OPHN1processed_transcriptintron-2
ENST00000516336.1ENSG00000252145.1RNU6-1225PsnRNAexon-1
ENST00000355520.6ENSG00000079482.13OPHN1protein_codingintron-18
Conserved Sites na
snoRNA Num 1 snoRNA Guide Site U6:31
snoRNA Guide Detail

snoRNA Guide Site snoRNA Guide Base snoRNA Name Box Source Database
U6:31USNORA79H/ACAsnOPY
U6:31USNORA79H/ACAsnoRNABase
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID 24148649, 16381836

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1