RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

RNA-editing_site_51389

mod Site

chr16:57056369-57056370:+

mod Type

A-I

Sequence

GTGCAATGATAGGTCACTGCAGCCTCCAACTCCTGGGCTCA

Motif Score

noScore

RNA Structure Motif

.....((((.......))))(((.....)))

MFE

-2.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

DARNED, RADAR

Support sub-Dataset List

DARNED, RADAR

Cell/Tissue List

Seq Type List

Transcript ID List

ENST00000539144.5,ENST00000540182.5,ENST00000545081.5,ENST00000262510.10,ENST00000436936.5,ENST00000537056.5,ENST00000538453.5,ENST00000538110.5,ENST00000538805.5,ENST00000543030.5,ENST00000538778.5,ENST00000538930.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000539144.5	ENSG00000140853.15	NLRC5	protein_coding	intron-24
ENST00000540182.5	ENSG00000140853.15	NLRC5	nonsense_mediated_decay	intron-10
ENST00000545081.5	ENSG00000140853.15	NLRC5	nonsense_mediated_decay	intron-22
ENST00000262510.10	ENSG00000140853.15	NLRC5	protein_coding	intron-27
ENST00000436936.5	ENSG00000140853.15	NLRC5	protein_coding	intron-26
ENST00000537056.5	ENSG00000140853.15	NLRC5	nonsense_mediated_decay	intron-8
ENST00000538453.5	ENSG00000140853.15	NLRC5	nonsense_mediated_decay	intron-15
ENST00000538110.5	ENSG00000140853.15	NLRC5	protein_coding	intron-21
ENST00000538805.5	ENSG00000140853.15	NLRC5	protein_coding	intron-22
ENST00000543030.5	ENSG00000140853.15	NLRC5	protein_coding	intron-19
ENST00000538778.5	ENSG00000140853.15	NLRC5	retained_intron	intron-9
ENST00000538930.5	ENSG00000140853.15	NLRC5	retained_intron	intron-9

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

ADAR

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
ADAR	ADAR:CH33820	chr16:57056295-57056495	SBDH190-8310

PubMed ID

21960545, 24163250

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.