Details of RNA Modification Site of hg38
mod ID RNA-editing_site_75938 mod Site chr2:45937508-45937509:+
mod Type A-I Sequence GATCACGAGGTCAGGAGATGAAGACCATCCTGGCTAATACG
Motif Score noScore
RNA Structure Motif ...((((((((...........)))))))).
MFE -11.10
Support Dataset Num 2 Support sub-Dataset Num 2
Support Dataset List DARNEDRADAR
Support sub-Dataset List DARNED, RADAR
Cell/Tissue List na
Seq Type List na
Transcript ID List ENST00000480453.5,ENST00000476675.5,ENST00000306156.8,rmsk_529056
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000480453.5ENSG00000171132.14PRKCEprocessed_transcriptintron-3
ENST00000476675.5ENSG00000171132.14PRKCEprocessed_transcriptintron-4
ENST00000306156.8ENSG00000171132.14PRKCEprotein_codingintron-2
rmsk_529056rmsk_529056AluYAluexon
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID 1534255724163250

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.


© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1